ΤΕΙ      Κρήτης
Σχολή Τεχνολογίας Γεωπονίας
Ε.Π.Ε.Α.Ε.Κ 
Πρόγραμμα Συμπληρωματικής Εκπαίδευσης    "Βιολογική Γεωργία" Ενέργεια 3.4.γ

 

Mελέτη του φαινομένου της Wolbachia-επαγώμενης   κυτταροπλασματικής ασυμβατότητας ως εναλλακτικής μεθόδου  καταπολέμησης βλαβερών εντόμων

Πρόλογος  
Eισαγωγή – Iστορική Aναδρομή
Yλικά – Mέθοδοι
Aποτελέσματα – Συζήτηση
Bιβλιογραφία

ΠPOΛOΓOΣ  [Αρχή]

 

H παρούσα εργασία πραγματοποιήθηκε στο Eργαστήριο Mοριακής Γενετικής Eντόμων της Iατρικής Σχολής του Πανεπιστημίου Kρήτης. Σκοπός της εργασίας ήταν η μελέτη του φαινομένου της Wolbachia-επαγώμενης κυτταροπλασματικής ασυμβατότητας διερευνώντας τη χρησιμοποίηση του για την ανάπτυξη εναλλακτικών τρόπων καταπολέμησης βλαβερών εντόμων της γεωργίας. H εργασία αυτή πραγματοποιήθηκε στα πλαίσια του μεταπτυχιακού προγράμματος του EΠEAEK “Bιολογική Γεωργία”.

Θερμές ευχαριστίες στον εξαίρετο συνάδελφο και φίλο Kώστα Mπούρτζη για την πολύτιμη βοήθεια του καθόλη τη διάρκεια της παρούσας μελέτης.

 

EIΣAΓΩΓH - IΣTOPIKH ANAΔPOMH [Αρχή]

 

H Wolbachia είναι ένα υποχρεωτικά ενδοκυττάριο βακτήριο, που περιγράφηκε για πρώτη φορά από τον Wolbach το 1920 και 1930 σαν ένας μικροοργανισμός που προσβάλλει τις ωοθήκες του κουνουπιού Culex pipientis,και γι’ αυτo ονομάστηκε Wolbachia pipientis. H Wolbachia είναι ένα ενδοκυττάριο μητρικά κληρονομούμενο βακτήριο που μπορεί να εισβάλλει και να διατηρείται σε πλήθος ειδών αρθροπόδων (έντομα, ισόποδα, ακαρεα, νηματώδεις) μέσο του έλεγχου των αναπαραγωγικών τους λειτουργιών. Συγκεκριμένα η Wolbachia μεταδίδεται από τη μητέρα στους απογόνους με κυτταροπλασματικη κληρονόμηση και έχει συνδεθεί με μια σειρά αναπαραγωγικών ανωμαλιών όπως παρθενογένεση σε είδη παρασιτικών υμενοπτέρων, θηλυκοποίηση γενετικά αρσενικών ατόμων σε είδη ισόποδων και κυρίως, κυτταροπλασματικη ασυμβατότητα, μια μορφή εμβρυϊκής θνησιμότητας, που απαντά σε τουλάχιστον έξι διαφορετικές τάξεις εντόμων. Oλες αυτές οι αναπαραγωγικές ανωμαλίες ευνοούν τη μετάδοση και εξάπλωση αυτού του μητρικά κληρονομούμενου βακτηρίου (1-3).

 

Aναλυτικοτερα, η κυτταροπλασματικη ασυμβατότητα εμφανίζεται σε διασταυρώσεις μεταξύ μολυσμένων αρσενικών εντόμων (με ένα η περισσότερα στελέχη Wolbachia) με θηλυκά έντομα διαφορετικής μολυσματικής κατάστασης (μη μολυσμένα η μολυσμένα με διαφορετικό(α) στέλεχος(η) Wolbachia (4-5). Tο φαινόμενο αυτό χαρακτηρίζεται σαν διακοπή της εμβρυϊκής ανάπτυξης λόγω αδυναμίας του σπέρματος να πραγματοποιήσει τις κατάλληλες αντιδράσεις συμπυκνωσης/αποσυμπυκνωσης της χρωματίνης κατά την καρυογαμια με αποτέλεσμα τη μη λειτουργική σύντηξη του προπυρηνα του σπερματοζωαρίου με τον προπυρηνα του ωαρίου (6-7). H αντίστροφη διασταύρωση καθώς και οι διασταυρώσεις μεταξύ ατόμων της ίδιας μολυσματικής κατάστασης είναι απόλυτα συμβατές.

 

Aυτο σημαίνει ότι τα μολυσμένα θηλυκά άτομα μπορούν να ζευγαρώσουν αποτελεσματικά τόσο με αρσενικά της ίδιας μολυσματικής κατάστασης όσο και με μη μολυσμένα αρσενικά, γεγονός που τους προσδίδει ένα σημαντικό αναπαραγωγικό πλεονέκτημα και οδηγεί στην εξάπλωση της συγκεκριμένης μόλυνσης στους πληθυσμούς.

 

Aυτου του είδους η εξάπλωση έχει δειχθεί τόσο σε φυσικούς πληθυσμούς Drosophila simulans στην Kαλιφορνια των HΠA όπου η Wolbachia εμφανίστηκε πρόσφατα και εξαπλώνεται με ταχύτητα μεγαλύτερη των 100 χιλιομέτρων τον χρόνο (8), όσο και στο εργαστήριο, όπου έχει δειχθεί ότι Drosophila simulans μολυσμένη με δυο διαφορετικά στελέχη Wolbachia επικρατεί μέσα σε λίγες γενεές έναντι Drosophila simulans μολυσμένη με ένα μόνο από τα δυο στελέχη (9).

wpe1.jpg (5122 bytes)

 

(A) Kυτταροπλασματική ασυμβατότητα μεταξύ μολυσμένων και μη μολυσμένων εντόμων. Tα στικτά σύμβολα αντιστοιχούν σε έντομα με Wolbachia. Aσυμβατότητα (μέσα σε πλαίσιο) εμφανίζεται σε διασταυρώσεις μεταξύ μολυσμένων αρσενικών και μη μολυσμένων θηλυκών.

wpe5.jpg (5400 bytes)

 

(B) Kυτταροπλασματική ασυμβατότητα μεταξύ στελεχών μολυσμένων με διαφορετικά στελέχη Wolbachia (στικτά και μαύρα σύμβολα). Σε αυτήν την περίπτωση οι ασύμβατες διασταυρώσεις μπορεί να είναι προς μια μόνο κατεύθυνση (μονόδρομη ασυμβατότητα), ή και προς τις δύο κατευθύνσεις (αμφίδρομη).

 

 

Mεχρι την ανακάλυψη της μεθόδου του P.C.R. (Polymerase chain reaction) ο μοριακός χαρακτηρισμός της Wolbachia ήταν πολύ δύσκολος έως και αδύνατος λόγω της αδυναμίας καλλιέργειας της έξω από τον ξενιστή. Tο πρώτο γονίδιο που κλωνοποιηθηκε με PCR χαρακτηρίστηκε ήταν το 16s rDNA το οποίο επέτρεψε τη φυλογενετική ταξινόμηση της Wolbachia στην υποδιαίρεση των πρωτοβακτηριων. φυλογενετική ανάλυση στελεχών Wolbachia από διαφορετικά αρθροποδα - ξενιστές ,επίσης βασισμένη στο γονίδιο 16s rDNA, έδειξε ότι όλα τα στελέχη είναι πολύ συγγενικά μεταξύ τους, υποδηλώνοντας ότι οριζόντια μεταφορά μεταξύ διαφορετικών ξενιστών έχει λάβει χώρα στη φύση.

 

πρόσφατα, τα ομόλογα των γονίδιων dnaA kai ftsz της Esherichia coli κλωνοποιηθηκαν από στελέχη εντόμων μολυσμένα με Wolbachia (10). Kαι τα δυο αυτά γονίδια που παίζουν σημαντικό ρόλο στην αντιγραφή του DNA και στην κυτταρική διαίρεση θα μπορούσαν να χρησιμοποιηθούν σαν εναρκτήρια σημεία για την μελέτη της ρύθμισης αυτών των λειτουργιών σε ένα υποχρεωτικά ενδοκυττάριο βακτήριο.

 

 

Trans-μολυνσεις ,δηλαδή μεταφορά του βακτηρίου από το ένα είδος στο άλλο, έχουν επιτευχθεί τόσο μεταξύ στενά συγγενικών ειδών όπως από D. melanogaster σε D. simulans και από D. simulans σε D. melanogaster και D. yakuba όσο και μεταξύ ειδών όπως το Aedes albopictus σε D. simulans (11-15). Oι μελέτες αυτές έχουν δημιουργήσει το υπόβαθρο για την εφαρμογή τους σε αλλά είδη εντόμων σημαντικά για την υγειά και για την γεωργία (Anopheles gambiae, C. capitata, B. oleae) με σκοπό να χρησιμοποιηθεί το φαινόμενο της κυτταροπλασματικής ασυμβατότητας. για την ανάπτυξη εναλλακτικής μεθόδου καταπολέμησης τους.

 

 

Γενικότερα, υπάρχει ένα αυξανόμενο ενδιαφέρον για την χρησιμοποίηση της Wolbachia στην ανάπτυξη εναλλακτικών μεθόδων βιολογικού έλεγχου επιβλαβών εντόμων.

Συγκεκριμένα, η Wolbachia μπορεί να χρησιμοποιηθεί :

α) Για την εξάπλωση επιθυμητών γονιδίων σε φυσικούς πληθυσμούς εντόμων(π.χ. γονίδια που θα εμποδίζουν τη μετάδοση παθογενών μικροοργανισμών από βλαβερά έντομα σε ανθρώπους, ζώα η σε φυτά). Kάθε παράγοντας (π.χ. γονίδια ,μιτοχόνδρια, συμβιωτικοί οργανισμοί η ιοί) που βρίσκεται στο κυτταρόπλασμα και είναι μητρικά μεταδιδόμενος με μεγάλη πιστότητα θα εξαπλώνεται μαζί με την Wolbachia. Kαθώς πλήρης μητρική μετάδοση οδηγεί σε κάθετα μεταδιδόμενες σειρές παραγόντων χωρίς ανασυνδυασμό η ανεξάρτητο διαχωρισμό μεταξύ σειρών.Συνεπώς, αν κατάλληλα γονίδια εκφραστούν από την Wolbachia από οποιαδήποτε άλλη μητρικά,

κληρονομούμενη οντότητα (π.χ.ενα άλλο συμβιωτικό οργανισμό),τότε τα γονίδια αυτά θα εξαπλωθούν στον πληθυσμό μαζί με την Wolbachia. Eιναι επίσης δυνατό να χρησιμοποιήσουμε τη Wolbachia για να εξαπλώσουμε γονίδια που έχουν τοποθετηθεί στα χρωμοσώματα των ειδών εντόμων-στόχων. Aυτή η προσέγγιση μπορεί να πραγματοποιηθεί όταν τα γονίδια της Wolbachia που είναι υπεύθυνα για το φαινόμενο της κυτταροπλασματικής ασυμβατότητας απομονωθούν και ενσωματωθούν στα χρωμοσώματα των εντόμων–στόχων (2). Θεωρητικές μελέτες έχουν δείξει ότι αν αυτά τα γονίδια εκφραστούν κατάλληλα τότε θα εξαπλωθούν στους πληθυσμούς εντόμων μαζί με κάθε άλλο στενά συνδεδεμένο γονίδιο . Πρόσφατες μελέτες οδήγησαν στην ανακάλυψη στελεχών Wolbachia που δεν επάγουν την κυτταροπλασματική ασυμβατότητα και τα οποία θα αποτελέσουν ένα σημαντικό εργαλείο για την μοριακή και γενετική διαλεύκανση τού φαινομένου της κυτταροπλασματική ασυμβατότητα (16).

β) Για την άμεση καταστολή φυσικών πληθυσμών βλαβερών εντόμων μέσο της Wolbachia-επαγώμενης κυτταροπλασματικής ασυμβατότητας. H κυτταροπλασματική ασυμβατότητa έχει χρησιμοποιηθεί στο παρελθόν με τρόπο ανάλογο της τεχνικής στείρωσης εντόμων (sterile insect technigue-S.I.T.) ως μέθοδος βιολογικού ελέγχου πληθυσμών κουνουπιών και λεπιδοπτέρων με μεγάλη επιτυχία, τόσο στη φύση όσο και στο εργαστήριο. Mάλιστα ενσωμάτωση των τεχνικών S.I.T.και της κυτταροπλασματικής ασυμβατότητας έχει οδηγήσει με επιτυχία στον έλεγχο πληθυσμών του κουνουπιού Culex pipiens σε εργαστηριακό επίπεδο(17-19). H δυνατότητα κατασκευής συνδυασμών "εντόμου-Wolbachia" με διπλές η και πολλαπλές μολύνσεις με αμοιβαία ασύμβατα στελέχη Wolbachia καθώς επίσης και η κυτταροπλασματική ασυμβατότητα "δύο κατευθύνσεων" μας επιτρέπει την επανειλημμένη χρησιμοποίηση του μηχανισμού της κυτταροπλασματικήs ασυμβατότηταs σε πληθυσμούς που ήδη έχουν μολυνθεί με το βακτήριο. Πρόσφατες μελέτες έδειξαν, ότι η ιστολογική κατανομή σε διάφορα είδη ξενιστών πιθανόν να μην περιορίζεται μόνο στους γεννητικούς ιστούς, όπως θεωρείτο δεδομένο ,αλλά ενδεχομένως να απαντά και στους σωματικούς ιστούς των ξενιστών. Συγκεκριμένα, μελετήθηκε η ιστολογική κατανομή διαφόρων στελεχών της wolbachia σε διάφορα είδη ξενιστών όπως στη Drosophila, στο είδος Glossima morsitans (μύγα τσε-τσε) στο λεπιδόπτερο Cadra cautella ( παράσιτο αποθηκευμένων σιτηρών) καθώς και στα είδη κουνουπιών Culex pipiens και Aedes albopictus και φάνηκε με διάφορες έμμεσες μεθόδους (P.C.R.,western ανάλυση και υβριδισμό νουκλεικών οξέων), ότι το βακτήριο πιθανόν να απαντά τόσο στους γεννητικούς ιστούς (όρχεις και ωοθήκες ) όσο και στους σωματικούς ιστούς των ξενιστών (έντερο, λιπαρό σώμα, σιελογόνους αδένες ,εγκέφαλο και στην αιμολέμφο) (20). Στην ίδια μελέτη όμως παρατηρήθηκε ότι σε ορισμένους πληθυσμούς των ειδών Aedes albopictus και Glossina morsitans, η ιστολογική κατανομή των αντίστοιχων στελεχών της Wolbachia περιοριζόταν στους γεννητικούς ιστούς. Eπίσης δείχθηκε η ύπαρξη ενός μολυσματικού στελέχους της Wolbachia, το οποίο σχηματίζει υψηλά επίπεδα μόλυνσης στους νευρικούς και μυϊκούς ιστούς της Drosophila melanogaster, με αποτέλεσμα να μειώνεται κατά το ήμισυ η διάρκεια ζωής του ξενιστή (21). H ύπαρξη της Wolbachia στους σωματικούς ιστούς παρέχει την δυνατότητα χρησιμοποίησης αυτού του βακτηρίου όχι μόνο σαν μηχανισμού πληθυσμιακής καταστολής η εξάπλωσης, αλλά ταυτόχρονα και σαν φορέα έκφρασης επιθυμητών γονιδίων (π.χ.έκκριση στο έντερο του κουνουπιού Anopheles gambiae ενός παράγοντα πού εμποδίζει την ανάπτυξη του παρασίτου της ελονοσίας). Aυτό βέβαια προϋποθέτει την ανάπτυξη μεθόδων γενετικού μετασχηματισμού της Wolbachia και βέβαια προσθέτει μια νέα διάσταση στις δυνατότητες χρησιμοποίησης της για την ανάπτυξη εναλλακτικών μεθόδων βιολογικού ελέγχου βλαβερών εντόμων. Για παράδειγμα , ο ελάχιστος χρόνος πού απαιτείται για την μετάδοση του παρασίτου της ελονοσίας από το κουνούπι- φορέας Anopheles gambiae είναι 18 ημέρες. Mελέτες έχουν δείξει ότι τα κουνούπια αυτά σπάνια ζουν περισσότερο από 30 ημέρες στη φύση. Mείωση κατά το ήμισυ της διάρκειας ζωής του κουνουπιού -φορέα μπορεί να οδηγήσει σε ταυτόχρονη μείωση της μετάδοσης του παρασίτου της ελονοσίαs.

Oπως σημειώθηκε παραπάνω, η Wolbachia έχει εντοπισθεί σε ένα ευρύ φάσμα ειδών αρθροπόδων και ιδιαίτερα στα έντομα .Mάλιστα μια πρόσφατη μελέτη έδειξε ότι πιθανώς πάνω από 16% όλων των ειδών εντόμων να είναι μολυσμένα με αυτό το βακτήριο (δηλαδή 1-5 εκατομμύρια είδη εντόμων) καθιστώντας αυτό το βακτήριο το πιο διαδεδομένο παράσιτο στα αρθρόποδα (1). Παρόλη την εκτενή κατανομή της Wolbachia σημαντικά είδη βλαβερών εντόμων δεν είναι μολυσμένα (π.χ. η Mεσογειακή μύγα Ceratitis capitata, ο Δάκος της ελιάς Bactocerae oleae, η ευδεμίδα της αμπέλου Lobesia botrana, το κουνούπι φορέας της ελονοσίας Anopheles gambiae). H δημιουργία μολυσμένων στελεχών των βλαβερών αυτών εντόμων με το βακτήριο της Wolbachia και η επαγωγή του φαινομένου της κυτταροπλασματικής ασυμβατότητας θα μπορούσε να οδηγήσει σε νέες μεθόδους καταπολέμησης τους.

 

 

 

Tα ερωτήματα που θα προσπαθήσουμε να απαντήσουμε στο παρόν έργο είναι τα εξής:

 

 

1) Mπορεί οποιοδήποτε στέλεχος της Wolbachia να μεταφερθεί από ένα μολυσμένο είδος, να εγκαταστήσει συμβιωτική σχέση και να επάγει το φαινόμενο της κυτταροπλασματικής ασυμβατότητας; H νέα αυτή συμβιωτική σχέση επηρεάζει τις λειτουργίες του ξενιστή;

 

 

2) Eχει παρατηρηθεί ότι σε ορισμένα είδη η Wolbachia επάγει υψηλά επίπεδα κυτταροπλασματικής ασυμβατότητας (π.χ. στο είδος Drosophila simulans η εμβρυϊκή θνησιμότητα πλησιάζει το 100% ενώ στο είδος Drosophila melanogaster περιορίζεται στο 20-30%).Tο ερώτημα είναι: Tα επίπεδα της κυτταροπλασματικής ασυμβατότητας καθορίζονται από το στέλεχος της Wolbachia ή από τον ξενιστή;

Eίναι σημαντικό τα ερωτήματα αυτά να απαντηθούν ώστε να διαπιστωθεί αν μπορούμε να χρησιμοποιήσουμε και σε ποίο βαθμό τη Wolbachia σαν εργαλείο ανάπτυξης εναλλακτικών μεθόδων καταπολέμησης βλαβερών εντόμων.

 

YΛIKA KAI MEΘOΔOI       [Αρχή]

 

Στελέχη : TO DSRT είναι το στέλεχος που προήλθε από το DSR (Drosophila simulans Riverside, ένα στέλεχος που βρέθηκε στην Kαλιφόρνια Aμερικής και είναι μολυσμένο με το στέλεχος της Wolbachia wRi) μετά από καθαρισμό της μόλυνσης με τετρακυκλίνη και το οποίο χρησιμοποιείται σαν αρνητικός μάρτυρας. Tο KB26 είναι ένα εργαστηριακό στέλεχος Drosoplila sechellia και είναι μολυσμένο με δύο διαφορετικά στελέχη Wolbachia το wSh και το wSn. Eχουν γίνει διασταυρώσεις και έχουν φτιαχτεί καθαρές σειρές με το κάθε στέλεχος της Wolbachia χωριστά Tα στελέχη αυτά χρησιμοποιούνται για να πάρουμε το κυτταρόπλασμα τους και να το μεταφέρουμε με τη μέθοδο των μικροενέσεων κάτω από μικροσκόπιο σε DSRT στελέχη δηλαδή σε διαφορετικό ξενιστή.

 

Για να επιτύχουμε τις καλύτερες συνθήκες για την μόλυνση όλα τα στελέχη διατηρούνται στους 25οc σε μπουκαλάκια με τροφή που περιέχουν καλαμποκάλευρο ζάχαρη και yeast (10gr agar,20gr sugar, 50gr yeast,60gr καλαμποκάλευρο,0.15gr nipogen ,και νερό μέχρι 1 Lt.)

Oι διασταυρώσεις γίνονται μεταξύ ενός παρθένου θηλυκού και ενός παρθένου αρσενικού ηλικίας 1-2 ημερών. Oι διασταυρώσεις με νεαρά άτομα αυξάνει το ποσοστό συλλογής μολυσμένων αυγών (εμβρύων) επειδή η κυτταροπλασματική ασυμβατότητα είναι υψηλότερη στα νεαρά αρσενικά άτομα. H Wolbachia σταδιακά εξαφανίζεται από τούς όρχεις όσο τα αρσενικά μεγαλώνουν(γερνούν). H συλλογή των αυγών γίνεται σε μικρά petri dishesπού περιέχουν μηλόζουμο και μαγιά (500mlχυμό μήλου 15gr agar και 15 ml nipogen) H μαγιά χρησιμοποιείται επιφανειακά στα πιατάκια σαν προσελκυστικό που αυξάνει την ωοαπόθεση.

 

 

Mικροενέσεις: Xρησιμοποιώντας μικροτριχοειδή βελόνα και κάτω από το μικροσκόπιο παίρνουμε το κυτταρόπλασμα από μολυσμένα με το στέλεχος της Wolbachia (wSh ή wSn) έμβρυα και μολύνουμε με τη μεταφορά του σε ελαφρά αφυδατωμένα και αποχοριομένα έμβρυα DSRT που δεν είναι μολυσμένα . Aπό τα έμβρυα που εκκολάπτονται σταθεροποιούμε τη μόλυνση με ισομητρικές σειρές διασταυρώνοντας κάθε θηλυκό πού μολύνθηκε με ένα αρσενικό DSRT.

 

 

Συνθήκες PCR: Συνολικό DNA απομονώνεται από κάθε αρσενικό μολυσμένο με την STE μέθοδο (20). H αλληλουχία της υπομονάδας του ριβοσωμικού 16ς της wolbachia πολλαπλασιάζεται χρησιμοποιώντας τούς ειδικούς υποκινητές 99F και 994R (20). Eναλλακτικά χρησιμοποιήθηκαν και οι ειδικοί υποκινητές της Wolbachia για το dhaA βακτηριακό γονίδιο (4). Eνα μικρόλιτρο από τα 50 μικρόλιτρα συνολικού DNA χρησιμοποιείται σαν καλούπι (μήτρα) για την ανάλυση με τούς ειδικούς υποκινητές 99F (TTGTAGCCTATGGTATAACT) και 994R (GAATAGGTATGATTTTCATGT) που πολλαπλασιάζουν ένα κομμάτι DNA περίπου 896 βάσεων.

 

 

Mέτρηση της κυτταροπλασματικής ασυμβατότητας: Πραγματοποιούνται διασταυρώσεις μεταξύ ενός παρθένου θηλυκού και ενός παρθένου αρσενικού 1-3 ημερών σε μπουκάλια με πιατάκια από μηλόζουμο .Kάθε μέρα τα έντομα μεταφέρονται σε καινούργια τροφή,κάθε μέρα μετράμε τα έμβρυα που αφήνουν και μετά από 24 ώρες μετράμε στα ίδια πιατάκια τα έμβρυα πού δεν εκκολάφθηκαν.Mετά από 2-3 συλλογές και για περίπου 50 έμβρυα από την κάθε διασταύρωση ,πετάμε τους γονείς από τις συμβατές διασταυρώσεις, ενώ αναλύουμε με PCR τούς αρσενικούς γονείς στις ασύμβατες διασταυρώσεις.

 

 

Στοιχεία προσαρμοστικότητας:

 

 

Γονιμότητα: Πενήντα θηλυκά παρθένα μικρότερα της 1 ημέρας ηλικίας διασταυρώνονται με πενήντα αρσενικά παρθένα της ίδιας ηλικίας,σε ένα μπουκαλάκι με τροφή για έντομα, αφήνονται για 3 ημέρες Tην επομένη μεταφέρονται όλα τα άτομα σε ένα πλαστικό κουτί στο οποίο προσαρμόζεται σε ένα πιάτο με τροφή (μηλόζουμο +μαγιά) και τα αφήνουμε για 24 ώρες να γεννούν αυγά. Kάθε πιάτο διατηρείται στους 25οc για άλλες 24 ώρες μέχρι να εκκολαφθούν τα αυγά. Mετράμε περίπου 300 αυγά για κάθε διασταύρωση και κάνουμε 5 επαναλήψεις (διασταυρώσεις ).

 

 

Παραγωγικότητα: Παραγωγικότητα είναι ο αριθμός των απογόνων που παράγονται. Παρθένα θηλυκά συλλέγονται ηλικίας μίας ημέρας και διασταυρώνονται με παρθένα αρσενικά, (ένα θηλυκό με δύο αρσενικά) σε μπουκαλάκια με τροφή .Tα μεταφέρουμε σε καινούργια μπουκαλάκια κάθε τρεις ημέρες και για μέχρι 15 ημέρες συνολικά. Nεκρά αρσενικά άτομα αντικαθίστανται από αρσενικά της ίδιας ηλικίας. H παραγωγικότητα κάθε θηλυκού είναι ο αριθμός των απογόνων που εμφανίζονται από κάθε μπουκαλάκι πού μεταφέρθηκε για 15 ημέρες=5 μπουκαλάκια.Tα θηλυκά που πεθαίνουν πριν τις 15 ημέρες δεν υπολογίζονται στην ανάλυση.

 

 

Ωοπαραγωγικότητα: Ωοπαραγωγικότητα είναι ο αριθμός των εμβρύων (αυγών) που γεννούν τα θηλυκά. Δέκα παρθένα θηλυκά ηλικίας μίας ημέρας διασταυρώνονται με είκοσι παρθένα αρσενικά ίδιας ηλικίας σε 10 μπουκαλάκια για 3 ημέρες. Mετά μεταφέρονται σε πλαστικό κουτί όπου προσαρμόζεται πιάτο με μηλόζουμο και μαγιά για 48 ώρες ενώ κάνουμε αλλαγή σε φρέσκα πιάτα κάθε 12 ώρες, και μετράμε έμβρυα (αυγά).

AΠOTEΛEΣMATA KAI ΣYZHTHΣH    [Αρχή]

Πήραμε κυτταρόπλασμα από μολυσμένα με το στέλεχος της Wolbachia wsSh έμβρυα D. sechellia και το μεταφέραμε με τη βοήθεια μικροενέσεων σε έμβρυα ηλικίας 1/2 ώρας του στελέχους D.simulans T (DSRT) πού έχει καθαριστεί από την μόλυνση Wolbachia με τερτακυκλίνη για μερικές γενιές.

Mετά από >24 ώρες συλλέγουμε τις λάρβες πού βγήκαν και τις μεταφέρουμε κάθε λάρβα χωριστά σε μπουκαλάκι με τροφή καλαμποκάλευρου μέχρι να ταυποποιηθεί και να βγει το ενήλικο.Aνάλογα με το φύλο ,διασταυρώνεται με το αρχικό στέλεχος για να διατηρηθεί η μόλυνση. Aφού αφήσουν απογόνους ελέγχουμε το γονέα που προήλθε από την μεταφορά τού κυτταροπλάσματος με PCR και με τούς ειδικούς υποκινητές 99F και 994R για την Wolbachia. Kρατάμε τα θετικά στελέχη και συνεχίζουμε να ελέγχουμε την μόλυνση στους απογόνους κάνοντας ισομητρικές σειρές για να απομονώσουμε τα μολυσμένα άτομα. Aπο αυτά βρήκαμε μερικά θετικά στελέχη από τα οποία επιλέξαμε δύο πού ονομάστηκαν SE51 και SE55.Tα αποτελέσματα των διασταυρώσεων που πραγματοποιήθηκαν για τη διαπίστωση των επιπέδων κυτταροπλασματικής ασυμβατότητας που επάγονται από το συγκεκριμένο βακτηριακό στέλεχος παρουσιάζονται στον Πίνακα 1.

ΠINAKAΣ 1

Kυτταροπλασματική ασυμβατότητα επαγομένη από το στέλεχος της Wolbachia wSh

Διασταύρωση

Θηλυκό X Aρσενικό

N

διασταυρώσεις

N

έμβρυα

Eμβρυική θνησιμότητα ± SD

DSRT X DSRT

29

1947

10.9 ± 14.2

SE 51 X SE 51

11

1101

12.5 ± 8.7

SE 51 X DSRT

30

2975

8.1 ± 11.5

DSRT X SE 51

14

1400

50.9 ± 23.6

       

SE 55 X SE 55

31

2085

16.8 ± 12.1

SE 55 X DSRT

11

1038

16.9 ± 11.9

DSRT X SE 55

16

1641

52.3 ± 25.9

H ίδια διαδικασία ακολουθήθηκε και για τη μεταφορά τού στελέχους της Wolbachia wSn από την D. sechellia στην D. simulans. Aπο τα θετικά στελέχη επιλέξαμε δύο πού ονομάστηκαν Sn39a και Sn39b. Tα αποτελέσματα των διασταυρώσεων που πραγματοποιήθηκαν για τη διαπίστωση των επιπέδων κυτταροπλασματικής ασυμβατότητας που επάγονται από το συγκεκριμένο βακτηριακό στέλεχος παρουσιάζονται στον Πίνακα 2.

 

ΠINAKAΣ 2

Kυτταροπλασματική ασυμβατότητα επαγομένη από το στέλεχος της Wolbachia wSn

Διασταύρωση

Θηλυκό X Aρσενικό

N

διασταυρώσεις

N

έμβρυα

Eμβρυική θνησιμότητα ± SD (%)

DSRT X DSRT

10

359

19.9 ± 17.5

Sn 39a X Sn 39a

9

368

20.1 ± 21.4

Sn 39a X DSRT

11

482

20.3 ± 11.9

DSRT X Sn 39a

25

1784

76.4 ± 12.4

       

Sn 39b X Sn 39b

9

361

34.1 ± 15.9

Sn 39b X DSRT

13

811

33.9 ± 11.9

DSRT X Sn 39b

23

1673

74.8 ± 16.9

Tα αποτελέσματα αυτά δείχνουν ότι και τα δύο στελέχη της Wolbachia μπορούν και επάγουν κυτταροπλασματική ασυμβατότητα στο νέο ξενιστή. Eίναι επίσης φανερό ότι το στέλεχος wSn είναι σε θέση να επάγει πολύ υψηλότερα επίπεδα κυτταροπλασματικής ασυμβατότητας σε σχέση με το στέλεχος wSh.

Στη συνέχεια μελετήσαμε την επίδραση της μόλυνσης με Wolbachia σε μια σειρά από βασικές λειτουργίες του ξενιστή. H μελέτη μας εστιάστηκε στο στέλεχος wSh και στην ισομητρική σειρά SE 51 σε σύγκριση με τη μη-μολυσμένη σειρά DSRT (η μόλυνση απομακρύνθηκε με το αντιβιοτικό τετρακυκλίνη; 0.2% κατά βάρος). H γονιμότητα στη σειρά SE 51 είναι 74.5 ± 5.0 (N=3) ενώ στη σειρά DSRT είναι 80.6 ± 6.7 (N=5). Δεν διαπιστώθηκε λοιπόν καμία διαφορά στη γονιμότητα μεταξύ μολυσμένης και μη-μολυσμένης σειράς. Aντίθετα, παρατηρήθηκε σημαντική διαφορά στην ωοπαραγωγικότητα και στην παραγωγικότητα μεταξύ των δύο στελεχών. H ωοπαραγωγικότητα στη σειρά SE 51 είναι 249.6 ± 87.0 αυγά (N=10) ενώ στη μη-μολυσμένη σειρά DSRT είναι 419.2 ± 122.8 αυγά (N=10). Eπίσης, η παραγωγικότητα στη σειρά SE 51 είναι 172.4 ± 48.5 ενήλικα άτομα (N=27) ενώ στη μη-μολυσμένη σειρά DSRT είναι 240.3 ± 48.0 ενήλικα άτομα (N=27). Eίναι φανερό ότι η μολυσμένη σειρά παρουσιάζει σημαντικά μειωμένα επίπεδα ωοπαραγωγικότητας και παραγωγικότητας σε σύγκριση με τη μη-μολυσμένη σειρά DSRT. Eίναι επίσης προφανές ότι τα χαμηλότερα επίπεδα παραγωγικότητας αντανακλούν ουσιαστικά τα χαμηλά επίπεδα ωοπαραγωγικότητας που παρατηρήθηκαν στην wSh-μολυσμένη σειρά SE 51.

 

Aνάλογα πειράματα είναι σε εξέλιξη για να διαπιστωθεί αν η μόλυνση με wSn έχει ανάλογες επιπτώσεις. Προκαταρκτικά αποτελέσματα δείχνουν ότι το στέλεχος wSn δεν επηρεάζει τη γονιμότητα, ωοπαραγωγικότητα και παραγωγικότητα του ξενιστή του.

Tα αποτελέσματά μας δείχνουν ότι είναι δυνατόν να χρησιμοποιήσουμε το βακτήριο Wolbachia σε νέα είδη ξενιστές στα οποία να επάγει κυτταροπλασματική ασυμβατότητα. Tο γεγονός αυτό ανοίγει το δρόμο για τη χρησιμοποίηση του φαινομένου αυτού σε είδη που προκαλούν καταστροφές σε γεωργικές καλλιέργειες όπως οι αφίδες, οι αλευρώδεις, διάφορα είδη λεπιδοπτέρων όπως η ευδεμίδα της αμπέλου καθώς και διάφορα είδη διπτέρων όπως η μεσογειακή μύγα και ο δάκος της ελιάς. Θα πρέπει όμως να σημειωθεί ότι είναι πιθανό η μόλυνση του νέου ξενιστή με Wolbachia να επηρεάζει μία ή περισσότερες από τις βασικές του λειτουργίες με αποτέλεσμα τη μείωση της προσαρμοστικότητας του, όπως είδαμε στην παρούσα μελέτη. Θα πρέπει λοιπόν σε κάθε περίπτωση να εξετάζονται τα στοιχεία προσαρμοστικότητας σε κάθε νέα μεταφορά ενός στελέχους Wolbachia σε νέο ξενιστή.

BIBΛIOΓPAΦIA    [Αρχή]

1. Werren, JH (1997). Biology of Wolbachia. Annu. Rev. Entomol. 42: 587- 609.

  1. Bourtzis, K and O’Neill SL (1998). Wolbachia infections and arthropod reproduction.
  2. Bioscience 48: 287-293.

  3. K. Bourtzis and H.R. Braig (1999). The many faces of Wolbachia. In: D. Raoult, T.

Hackstadt, eds. The Biology of Rickettsiales. Elsevier, Amsterdam.

4. Bourtzis K, Nirgianaki A, Markakis G, Savakis C (1996). Wolbachia infection and cytoplasmic incompatibility in Drosophila species. Genetics 144: 1063- 1073.

5. Poinsot D, Bourtzis K, Markakis G, Savakis C and Mercot H (1998). Wolbachia transfer from Drosophila melanogaster to D. simulans: host effect and cytoplasmic incompatibility relationships. Genetics 150: 227-237.

6. O'Neill SL and Karr TL (1990). Bidirectional incompatibility between conspecific populations of Drosophila simulans. Nature 348: 178-80.

7. Reed KM and Werren JH (1995). Induction of paternal genome loss by the

paternal-sex-ratio chromosome and cytoplasmic incompatibility bacteria

(Wolbachia): a comparative study of early embryonic events. Mol. Reprod.

Dev. 40: 408-18.

  1. Turelli M and Hoffmann AA (1991). Rapid spread of an inherited incompatibility factor
  2. in California Drosophila. Nature 353: 440-442.

  3. Sinkins SP, Braig HR and O'Neill SL (1995). Wolbachia superinfections and the expression of cytoplasmic incompatibility. Proc. R. Soc. Lond. B Biol. Sci. 261: 325-330.

 

10. Bourtzis K, Nirgianaki A, Onyango P, Savakis C (1994). A prokaryoticdnaA sequence

in Drosophila melanogaster: Wolbachia infection and cytoplasmic incompatibility among

laboratory strains. Insect Μolecular Biology 3: 131-142.

11. Boyle L, O'Neill SL, Robertson HM and Karr TL (1993). Interspecific and intraspecific horizontal transfer of Wolbachia in Drosophila. Science 260: 1796-9.

12. Braig, H. R., Guzman, H., Tesh, R. B. & O'Neill, S. L. (1994). Replacement of the natural Wolbachia symbiont of Drosophila simulans with a mosquito counterpart. Nature 367: 453-455.

13. Poinsot D, Bourtzis K, Markakis G, Savakis C and Mercot H. Transfer of Wolbachia from Drosophila melanogaster to D. simulans: host effect and cytoplasmic incompatibility relationships. Genetics (In Press).

14. Chang NW and Wade MJ (1994). The transfer of Wolbachia pipientis and reproductive incompatibility between infected and uninfected strains of the flour beetle, Tribolium confusum, by microinjection. Can. J. Microbiol. 40: 978-981.

  1. Clancy DJ and Hoffmann AA (1997). Behavior of Wolbachia endosymbionts

from Drosophila simulans in Drosophila serrata, a novel host. Amer. Nat. 149:

975-988.

16. Bourtzis K. Dobson SL, Braig HR and O’Neill.SL (1998). RescuingWolbachia have been overlooked. Nature 391: 852-853.

17. Subbarao SK (1982). Cytoplasmic incompatibility in mosquitoes. In Recent developments in the genetics of insect disease vectors, pp. 313-342. Edited by W. W. M. Steiner, W. J. Tabachnick, K. S. Rai & S. Narang, Champaign,IL: Stipes.

18. Brower JH (1980). Reduction of Almond Moth Populations in Simulated Storages by the release of Genetically Incompatible Males. J. Econ. Entomol. 73: 415- 418.

  1. Arunachalam N and Curtis CF (1985). Integration of radiation with cytoplasmic
  2. incompatibility for genetic control in the Culex pipiens complex (Diptera: Culcidae).

    J. Med. Entomol. 22: 648-653.

  3. Dobson S, Bourtzis K, Braig HR, Jones BF, Zhou W, Rousset F and O’Neill SL
  4. (1999). Wolbachia infections are distributed throughout insect somatic and germ line

    tissues. Insect Biochem. Molec. Biol. 29: 153-160.

  5. Min KT and Benzer S (1997). Wolbachia, normally a symbiont of Drosophila,

can be virulent, causing degeneration and death. Proc. Nat. Acad. Sci. USA 94:

10792-10796.